Transcript: Mouse NM_001286040.1

Mus musculus ankyrin repeat and SAM domain containing 1 (Anks1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Anks1 (224650)
Length:
7092
CDS:
157..3726

Additional Resources:

NCBI RefSeq record:
NM_001286040.1
NBCI Gene record:
Anks1 (224650)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001286040.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424676 ACGCGTAGATAAGAAGTATTT pLKO_005 1470 CDS 100% 13.200 18.480 N Anks1 n/a
2 TRCN0000323366 AGCACGAGATCCGGAACATTT pLKO_005 3212 CDS 100% 13.200 18.480 N ANKS1A n/a
3 TRCN0000437639 GCGGTTATGAGGCCAATTATC pLKO_005 3023 CDS 100% 13.200 18.480 N Anks1 n/a
4 TRCN0000121419 CCGAACGTGAACTGTGTAGAT pLKO.1 355 CDS 100% 4.950 6.930 N Anks1 n/a
5 TRCN0000121418 GCTTCCAACAAGAACGTCATT pLKO.1 3187 CDS 100% 4.950 6.930 N Anks1 n/a
6 TRCN0000121421 CCAGATAGTACGTCTGCTCAT pLKO.1 522 CDS 100% 4.050 5.670 N Anks1 n/a
7 TRCN0000422231 GACTGAGCTGATCCTTCATTT pLKO_005 1239 CDS 100% 13.200 9.240 N Anks1 n/a
8 TRCN0000438543 GGCTGCAGGAATCGATGTTAA pLKO_005 1008 CDS 100% 13.200 9.240 N Anks1 n/a
9 TRCN0000121420 CGCCCTGATTGAAGATCACAT pLKO.1 1104 CDS 100% 4.950 3.465 N Anks1 n/a
10 TRCN0000121417 CGTCCCTTTCAAGATTGGTTT pLKO.1 6394 3UTR 100% 4.950 3.465 N Anks1 n/a
11 TRCN0000148957 GAGTGGGATGAGATTGAGAAA pLKO.1 2203 CDS 100% 4.950 3.465 N ANKS1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286040.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.