Transcript: Human NM_001286075.1

Homo sapiens ATPase sarcoplasmic/endoplasmic reticulum Ca2+ transporting 1 (ATP2A1), transcript variant c, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
ATP2A1 (487)
Length:
3219
CDS:
209..2818

Additional Resources:

NCBI RefSeq record:
NM_001286075.1
NBCI Gene record:
ATP2A1 (487)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001286075.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426263 GTCATTGGGCTCGACGAAATC pLKO_005 2762 CDS 100% 10.800 15.120 N ATP2A1 n/a
2 TRCN0000422065 GAACTACCTAGAGGGATAACT pLKO_005 2800 CDS 100% 5.625 7.875 N ATP2A1 n/a
3 TRCN0000038470 CGCTGTAACTATGTGCGAGTT pLKO.1 1403 CDS 100% 4.050 5.670 N ATP2A1 n/a
4 TRCN0000425629 ACCCACTTTGAGGGCATAGAC pLKO_005 2474 CDS 100% 4.950 3.960 N ATP2A1 n/a
5 TRCN0000038471 GCCATCTACTACTTTAAGATT pLKO.1 707 CDS 100% 5.625 3.938 N ATP2A1 n/a
6 TRCN0000038472 CGAGTCTGTATCTGTCATCAA pLKO.1 379 CDS 100% 4.950 3.465 N ATP2A1 n/a
7 TRCN0000038469 CCAGCTAATGAAGAAGGAATT pLKO.1 1261 CDS 100% 0.000 0.000 N ATP2A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286075.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.