Transcript: Mouse NM_001286096.1

Mus musculus major urinary protein 2 (Mup2), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Mup2 (17841)
Length:
771
CDS:
120..479

Additional Resources:

NCBI RefSeq record:
NM_001286096.1
NBCI Gene record:
Mup2 (17841)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001286096.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000272112 ATGAAGAGTGCTCGGAATTAT pLKO_005 172 CDS 100% 15.000 7.500 Y Mup13 n/a
2 TRCN0000270002 TCTACGGGAAGGAACTTTAAT pLKO_005 137 CDS 100% 15.000 7.500 Y Mup10 n/a
3 TRCN0000272266 ACCTAAGACAGACTATGATAA pLKO_005 266 CDS 100% 13.200 6.600 Y Mup7 n/a
4 TRCN0000284694 CTATGGCCGAGAACCAGATTT pLKO_005 347 CDS 100% 13.200 6.600 Y Mup7 n/a
5 TRCN0000272111 CTTATGGCTCATCTCATTAAC pLKO_005 291 CDS 100% 13.200 6.600 Y Mup13 n/a
6 TRCN0000272269 GATGAAGAGTGCTCGGAATTA pLKO_005 171 CDS 100% 13.200 6.600 Y Mup8 n/a
7 TRCN0000281883 GTTCTACGGGAAGGAACTTTA pLKO_005 135 CDS 100% 13.200 6.600 Y Mup7 n/a
8 TRCN0000270001 TCTTATGGCTCATCTCATTAA pLKO_005 290 CDS 100% 13.200 6.600 Y Mup10 n/a
9 TRCN0000105448 TGACGTATGATGGATTCAATA pLKO.1 235 CDS 100% 13.200 6.600 Y Mup1 n/a
10 TRCN0000272237 TGATGGATTCAATACATTTAC pLKO_005 242 CDS 100% 13.200 6.600 Y Mup7 n/a
11 TRCN0000272050 TTCTACGGGAAGGAACTTTAA pLKO_005 136 CDS 100% 13.200 6.600 Y Mup13 n/a
12 TRCN0000272239 CCTAAGACAGACTATGATAAC pLKO_005 267 CDS 100% 10.800 5.400 Y Mup8 n/a
13 TRCN0000272291 CTATACCTAAGACAGACTATG pLKO_005 262 CDS 100% 10.800 5.400 Y Mup9 n/a
14 TRCN0000297085 GACGTATGATGGATTCAATAC pLKO_005 236 CDS 100% 10.800 5.400 Y Mup13 n/a
15 TRCN0000270003 GTCTCACTGAGAAGTCCAATT pLKO_005 594 3UTR 100% 10.800 5.400 Y Mup10 n/a
16 TRCN0000272268 TATGGCCGAGAACCAGATTTG pLKO_005 348 CDS 100% 10.800 5.400 Y Mup8 n/a
17 TRCN0000272270 GTGAATATTCTGTGACGTATG pLKO_005 223 CDS 100% 6.000 3.000 Y Mup8 n/a
18 TRCN0000105447 CGTATGATGGATTCAATACAT pLKO.1 238 CDS 100% 5.625 2.813 Y Mup1 n/a
19 TRCN0000272290 GAATATTCTGTGACGTATGAT pLKO_005 225 CDS 100% 5.625 2.813 Y Mup9 n/a
20 TRCN0000272250 CCATGCAGAAGAAGCTAGTTC pLKO_005 118 5UTR 100% 4.950 2.475 Y Mup9 n/a
21 TRCN0000105446 GCCGAGAACCAGATTTGAGTT pLKO.1 352 CDS 100% 4.950 2.475 Y Mup1 n/a
22 TRCN0000105463 TCCATGCAGAAGAAGCTAGTT pLKO.1 117 5UTR 100% 4.950 2.475 Y Mup2 n/a
23 TRCN0000272289 TGGCTCATCTCATTAACGAAA pLKO_005 295 CDS 100% 4.950 2.475 Y Mup9 n/a
24 TRCN0000105460 CCAATTCCAGTCTATCCACAT pLKO.1 609 3UTR 100% 4.050 2.025 Y Mup2 n/a
25 TRCN0000105462 GATAACTTTCTTATGGCTCAT pLKO.1 282 CDS 100% 4.050 2.025 Y Mup2 n/a
26 TRCN0000105445 CCCTTCCTATCCATACAGCAT pLKO.1 538 3UTR 100% 2.640 1.320 Y Mup1 n/a
27 TRCN0000105473 ACCTATCCAATGCCAATCGCT pLKO.1 439 CDS 100% 0.750 0.375 Y Mup5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286096.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.