Transcript: Human NM_001286213.1

Homo sapiens transmembrane protein 117 (TMEM117), transcript variant 4, mRNA.

Source:
NCBI, updated 2018-06-30
Taxon:
Homo sapiens (human)
Gene:
TMEM117 (84216)
Length:
2871
CDS:
664..1776

Additional Resources:

NCBI RefSeq record:
NM_001286213.1
NBCI Gene record:
TMEM117 (84216)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001286213.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421662 CACTAACCCTCGGACTAATAA pLKO_005 1326 CDS 100% 15.000 21.000 N TMEM117 n/a
2 TRCN0000415267 GCAACCTTGAGTGTAACTTTA pLKO_005 1809 3UTR 100% 13.200 18.480 N TMEM117 n/a
3 TRCN0000434111 ATCCCTGGTCTCGCATGATTG pLKO_005 396 5UTR 100% 10.800 15.120 N TMEM117 n/a
4 TRCN0000432837 ATTTGGTTCTTTGGACGATTT pLKO_005 1462 CDS 100% 10.800 15.120 N TMEM117 n/a
5 TRCN0000127552 CAGGACTAATAGCTGGCAAAT pLKO.1 597 5UTR 100% 10.800 15.120 N TMEM117 n/a
6 TRCN0000429691 GACTATATGGGCATCCGAAAT pLKO_005 658 5UTR 100% 10.800 15.120 N TMEM117 n/a
7 TRCN0000129891 GCTTACTTGGTGATCTTCTTT pLKO.1 419 5UTR 100% 5.625 7.875 N TMEM117 n/a
8 TRCN0000415301 AGTGGTGCCTTGAGACATTAA pLKO_005 2078 3UTR 100% 13.200 9.240 N TMEM117 n/a
9 TRCN0000429533 CATAACAGGCAAATGGTTTAA pLKO_005 1122 CDS 100% 13.200 9.240 N TMEM117 n/a
10 TRCN0000128099 CGGAGATAGACTTGGAGATAA pLKO.1 1780 3UTR 100% 13.200 9.240 N TMEM117 n/a
11 TRCN0000416783 GAACAGTTACCTAACCTATTT pLKO_005 2131 3UTR 100% 13.200 9.240 N TMEM117 n/a
12 TRCN0000416098 TTGGTCTTTGACCTTCTTATT pLKO_005 970 CDS 100% 13.200 9.240 N TMEM117 n/a
13 TRCN0000130692 CCTCACATGCAGTTCAAGATT pLKO.1 1060 CDS 100% 5.625 3.938 N TMEM117 n/a
14 TRCN0000128032 GCTCACAGTTGAACGAATCTA pLKO.1 1697 CDS 100% 5.625 3.938 N TMEM117 n/a
15 TRCN0000130979 CCAGAGCATTCCTTGCTTCTT pLKO.1 944 CDS 100% 4.950 3.465 N TMEM117 n/a
16 TRCN0000128307 GCACAAGCTATTACTGACTTT pLKO.1 2006 3UTR 100% 4.950 3.465 N TMEM117 n/a
17 TRCN0000414285 ATGTGGAAGAACCAAATATTT pLKO_005 1183 CDS 100% 15.000 9.000 N TMEM117 n/a
18 TRCN0000130730 GCCAAACAGAAGCCAATGTTA pLKO.1 477 5UTR 100% 5.625 3.375 N TMEM117 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286213.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.