Transcript: Human NM_001286372.1

Homo sapiens vesicle trafficking 1 (VTA1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-05
Taxon:
Homo sapiens (human)
Gene:
VTA1 (51534)
Length:
3195
CDS:
206..874

Additional Resources:

NCBI RefSeq record:
NM_001286372.1
NBCI Gene record:
VTA1 (51534)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001286372.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000072689 CCTTCTATACTGCAAGTCTTT pLKO.1 381 CDS 100% 4.950 3.960 N VTA1 n/a
2 TRCN0000380590 AGGCAACATACATCCATAATT pLKO_005 474 CDS 100% 15.000 10.500 N VTA1 n/a
3 TRCN0000381317 ACATGCCATCAGGCAACTATA pLKO_005 639 CDS 100% 13.200 9.240 N VTA1 n/a
4 TRCN0000380473 AGATAGCCAGAATATTCTAAA pLKO_005 1285 3UTR 100% 13.200 9.240 N VTA1 n/a
5 TRCN0000072691 GAAGGCAACATACATCCATAA pLKO.1 472 CDS 100% 10.800 7.560 N VTA1 n/a
6 TRCN0000072688 GCCTGGAAACTTGGTGCTTTA pLKO.1 1620 3UTR 100% 10.800 7.560 N VTA1 n/a
7 TRCN0000072692 GCAAATATGCTGGCAGTGCTT pLKO.1 777 CDS 100% 2.640 1.848 N VTA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286372.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08310 pDONR223 100% 72.3% 69.3% None 0_1ins79;31_32ins95;522_523ins81 n/a
2 ccsbBroad304_08310 pLX_304 0% 72.3% 69.3% V5 0_1ins79;31_32ins95;522_523ins81 n/a
Download CSV