Transcript: Human NM_001286661.2

Homo sapiens transmembrane protein 68 (TMEM68), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
TMEM68 (137695)
Length:
1994
CDS:
128..562

Additional Resources:

NCBI RefSeq record:
NM_001286661.2
NBCI Gene record:
TMEM68 (137695)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001286661.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000370176 TTCCTGGATAATGCGTTAAAT pLKO_005 927 3UTR 100% 15.000 21.000 N TMEM68 n/a
2 TRCN0000147520 GCCCTAATTAGTGATGAAACT pLKO.1 392 CDS 100% 4.950 6.930 N TMEM68 n/a
3 TRCN0000370175 GAGTAGTAGCTGATCACTTTG pLKO_005 243 CDS 100% 10.800 8.640 N TMEM68 n/a
4 TRCN0000147296 GAGTGCTTTGTTAGAACGTTT pLKO.1 593 3UTR 100% 4.950 3.960 N TMEM68 n/a
5 TRCN0000128075 GAGTTCGAGAAGCCCTAATTA pLKO.1 381 CDS 100% 15.000 10.500 N TMEM68 n/a
6 TRCN0000365124 GTAGGTCCTATAATTAGTATT pLKO_005 699 3UTR 100% 13.200 9.240 N TMEM68 n/a
7 TRCN0000124568 TGCCCATTATTCCTATGTTTA pLKO.1 471 CDS 100% 13.200 9.240 N Tmem68 n/a
8 TRCN0000128172 CAGGAAACATTATGAGTGCTT pLKO.1 580 3UTR 100% 2.640 1.848 N TMEM68 n/a
9 TRCN0000147088 CCAGCCTGAATGATGAATTTA pLKO.1 1752 3UTR 100% 15.000 9.000 N TMEM68 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286661.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.