Transcript: Human NM_001286993.1

Homo sapiens FYVE, RhoGEF and PH domain containing 3 (FGD3), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
FGD3 (89846)
Length:
3449
CDS:
611..2785

Additional Resources:

NCBI RefSeq record:
NM_001286993.1
NBCI Gene record:
FGD3 (89846)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001286993.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243296 GTTCAACAGCATGATCCTTTA pLKO_005 1792 CDS 100% 10.800 15.120 N FGD3 n/a
2 TRCN0000243300 AGAAGTCATCATGGGCATATT pLKO_005 1192 CDS 100% 13.200 9.240 N FGD3 n/a
3 TRCN0000243299 CAAAGTAACCATCATCCATAT pLKO_005 3042 3UTR 100% 10.800 7.560 N FGD3 n/a
4 TRCN0000149421 CAGAAGTCATCATGGGCATAT pLKO.1 1191 CDS 100% 10.800 7.560 N FGD3 n/a
5 TRCN0000183671 CATGGGCATATTCTCTAACAT pLKO.1 1201 CDS 100% 5.625 3.938 N FGD3 n/a
6 TRCN0000180171 CGGCGAGTATGTCAAGAACTT pLKO.1 1351 CDS 100% 4.950 3.465 N FGD3 n/a
7 TRCN0000243297 AGAGCTGAGTGGTAGCTTAAA pLKO_005 799 CDS 100% 13.200 7.920 N FGD3 n/a
8 TRCN0000243298 CAGCACATACATTCATCATAA pLKO_005 1911 CDS 100% 13.200 7.920 N FGD3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286993.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.