Transcript: Human NM_001287238.2

Homo sapiens family with sequence similarity 166 member B (FAM166B), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
FAM166B (730112)
Length:
1018
CDS:
51..842

Additional Resources:

NCBI RefSeq record:
NM_001287238.2
NBCI Gene record:
FAM166B (730112)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001287238.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000269741 GGGAGTGAAGAGCTACCAAAG pLKO_005 432 CDS 100% 6.000 8.400 N FAM166B n/a
2 TRCN0000269803 TGTCAGGCACTGCAGGAATTT pLKO_005 621 CDS 100% 13.200 10.560 N FAM166B n/a
3 TRCN0000269743 ACCCTCAGAACCCTCATTATA pLKO_005 85 CDS 100% 15.000 10.500 N FAM166B n/a
4 TRCN0000269744 ACTGGACACTGCCCACTACTT pLKO_005 117 CDS 100% 4.950 3.465 N FAM166B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001287238.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05739 pDONR223 100% 82.1% 67.8% None 493_524del;681_789del n/a
2 ccsbBroad304_05739 pLX_304 0% 82.1% 67.8% V5 493_524del;681_789del n/a
3 TRCN0000481257 CGTCCTTTACTCCTGCCCTTAGAT pLX_317 59.3% 82.1% 67.8% V5 493_524del;681_789del n/a
Download CSV