Transcript: Mouse NM_001287261.1

Mus musculus macrophage stimulating 1 receptor (c-met-related tyrosine kinase) (Mst1r), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Mst1r (19882)
Length:
1796
CDS:
50..1483

Additional Resources:

NCBI RefSeq record:
NM_001287261.1
NBCI Gene record:
Mst1r (19882)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001287261.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000023548 CGTCCTAGACAAGGAATACTA pLKO.1 973 CDS 100% 5.625 7.875 N Mst1r n/a
2 TRCN0000361458 TGTTGTCTACCACGGAGAATA pLKO_005 559 CDS 100% 13.200 9.240 N Mst1r n/a
3 TRCN0000121255 CGAGTCATTCACAGTCAAGGT pLKO.1 928 CDS 100% 2.640 1.848 N MST1R n/a
4 TRCN0000023545 CCCTGATCTTTAACTCCCGAA pLKO.1 282 CDS 100% 2.160 1.512 N Mst1r n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001287261.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.