Transcript: Human NM_001287802.1

Homo sapiens tubulin folding cofactor E (TBCE), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
TBCE (6905)
Length:
1948
CDS:
487..1731

Additional Resources:

NCBI RefSeq record:
NM_001287802.1
NBCI Gene record:
TBCE (6905)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001287802.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000084107 CAGACTTTCTTACTGCAATTA pLKO.1 327 5UTR 100% 13.200 9.240 N TBCE n/a
2 TRCN0000291743 CAGACTTTCTTACTGCAATTA pLKO_005 327 5UTR 100% 13.200 9.240 N TBCE n/a
3 TRCN0000084103 GTTCACCGGAAATAAATGATT pLKO.1 1779 3UTR 100% 5.625 3.938 N TBCE n/a
4 TRCN0000291684 GTTCACCGGAAATAAATGATT pLKO_005 1779 3UTR 100% 5.625 3.938 N TBCE n/a
5 TRCN0000084105 CCAGCTACTAACACTGAAGAT pLKO.1 1476 CDS 100% 4.950 3.465 N TBCE n/a
6 TRCN0000291683 CCAGCTACTAACACTGAAGAT pLKO_005 1476 CDS 100% 4.950 3.465 N TBCE n/a
7 TRCN0000084106 CCTGAAGATTGGGAACTCAAA pLKO.1 1429 CDS 100% 4.950 3.465 N TBCE n/a
8 TRCN0000291691 CCTGAAGATTGGGAACTCAAA pLKO_005 1429 CDS 100% 4.950 3.465 N TBCE n/a
9 TRCN0000084104 CCATCCTTGAAGTACCTGGTA pLKO.1 1066 CDS 100% 2.640 1.848 N TBCE n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001287802.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07034 pDONR223 100% 77.9% 77% None (many diffs) n/a
2 ccsbBroad304_07034 pLX_304 0% 77.9% 77% V5 (many diffs) n/a
Download CSV