Transcript: Human NM_001288590.2

Homo sapiens zinc finger with KRAB and SCAN domains 7 (ZKSCAN7), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
ZKSCAN7 (55888)
Length:
3455
CDS:
408..2672

Additional Resources:

NCBI RefSeq record:
NM_001288590.2
NBCI Gene record:
ZKSCAN7 (55888)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001288590.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000107399 CGAAATCTTCCGGCTACACTT pLKO.1 557 CDS 100% 4.950 6.930 N ZKSCAN7 n/a
2 TRCN0000107396 GCAATTGTGTTACCACGAGAT pLKO.1 581 CDS 100% 4.050 5.670 N ZKSCAN7 n/a
3 TRCN0000107397 CTCTGGGTACAACAAAGGAAT pLKO.1 880 CDS 100% 4.950 3.465 N ZKSCAN7 n/a
4 TRCN0000107398 GCATATGAGGACCTATCTGTA pLKO.1 1101 CDS 100% 0.000 0.000 N ZKSCAN7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001288590.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.