Transcript: Human NM_001288653.1

Homo sapiens clathrin heavy chain (CLTC), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
CLTC (1213)
Length:
8587
CDS:
444..5483

Additional Resources:

NCBI RefSeq record:
NM_001288653.1
NBCI Gene record:
CLTC (1213)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001288653.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380642 ACACTCGTGCAGTCAATTATT pLKO_005 4750 CDS 100% 15.000 21.000 N CLTC n/a
2 TRCN0000113161 GCGAACATCAATAGATGCTTA pLKO.1 4895 CDS 100% 4.950 6.930 N Cltc n/a
3 TRCN0000331948 GCGAACATCAATAGATGCTTA pLKO_005 4895 CDS 100% 4.950 6.930 N Cltc n/a
4 TRCN0000379759 ACACGTGTTATGGAGTATATT pLKO_005 3567 CDS 100% 15.000 12.000 N Cltc n/a
5 TRCN0000007984 GCCAATGTGATCTGGAACTTA pLKO.1 3226 CDS 100% 5.625 4.500 N CLTC n/a
6 TRCN0000342757 GCCAATGTGATCTGGAACTTA pLKO_005 3226 CDS 100% 5.625 4.500 N CLTC n/a
7 TRCN0000011216 CGGTTGCTCTTGTTACGGATA pLKO.1 808 CDS 100% 4.050 3.240 N CLTC n/a
8 TRCN0000342755 CGGTTGCTCTTGTTACGGATA pLKO_005 808 CDS 100% 4.050 3.240 N CLTC n/a
9 TRCN0000007981 CGTGTTCTTGTAACCTTTATT pLKO.1 5573 3UTR 100% 15.000 10.500 N CLTC n/a
10 TRCN0000342693 CGTGTTCTTGTAACCTTTATT pLKO_005 5573 3UTR 100% 15.000 10.500 N CLTC n/a
11 TRCN0000007983 CCTGTGTAGATGGGAAAGAAT pLKO.1 4231 CDS 100% 5.625 3.938 N CLTC n/a
12 TRCN0000007982 GCCCAAATGTTAGTTCAAGAT pLKO.1 2052 CDS 100% 4.950 3.465 N CLTC n/a
13 TRCN0000342691 GCCCAAATGTTAGTTCAAGAT pLKO_005 2052 CDS 100% 4.950 3.465 N CLTC n/a
14 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 7025 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001288653.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.