Transcript: Human NM_001288753.2

Homo sapiens structural maintenance of chromosomes 4 (SMC4), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-02
Taxon:
Homo sapiens (human)
Gene:
SMC4 (10051)
Length:
5041
CDS:
106..3897

Additional Resources:

NCBI RefSeq record:
NM_001288753.2
NBCI Gene record:
SMC4 (10051)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001288753.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108940 CGGCTAAATGAACCTATTAAA pLKO.1 814 CDS 100% 15.000 21.000 N Smc4 n/a
2 TRCN0000152212 CCACAAGAGTAGCATATCAAA pLKO.1 2201 CDS 100% 5.625 7.875 N SMC4 n/a
3 TRCN0000154901 GCCACAAGAGTAGCATATCAA pLKO.1 2200 CDS 100% 5.625 7.875 N SMC4 n/a
4 TRCN0000285427 GCCACAAGAGTAGCATATCAA pLKO_005 2200 CDS 100% 5.625 7.875 N SMC4 n/a
5 TRCN0000155428 CGGTAAATGAAGCACGTTCAA pLKO.1 1502 CDS 100% 4.950 6.930 N SMC4 n/a
6 TRCN0000150884 GCTATTACTAAAGCCCAAGTA pLKO.1 2785 CDS 100% 4.950 6.930 N SMC4 n/a
7 TRCN0000155500 CCTGCCAACTAATCTTGGATA pLKO.1 4253 3UTR 100% 4.950 3.960 N SMC4 n/a
8 TRCN0000275730 ACGGCTAAATGAACCTATTAA pLKO_005 813 CDS 100% 15.000 10.500 N SMC4 n/a
9 TRCN0000275659 AGACAATCACCACAGTTATTA pLKO_005 4309 3UTR 100% 15.000 10.500 N SMC4 n/a
10 TRCN0000275658 GAATTGACTTGGACCATAATA pLKO_005 680 CDS 100% 15.000 10.500 N SMC4 n/a
11 TRCN0000150860 GCCAACTAATCTTGGATAGAT pLKO.1 4256 3UTR 100% 5.625 3.938 N SMC4 n/a
12 TRCN0000154723 GCCCAACAAGACAAACTTGAT pLKO.1 2731 CDS 100% 4.950 3.465 N SMC4 n/a
13 TRCN0000275787 GCCCAACAAGACAAACTTGAT pLKO_005 2731 CDS 100% 4.950 3.465 N SMC4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001288753.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.