Transcript: Human NM_001288780.2

Homo sapiens membrane associated ring-CH-type finger 10 (MARCHF10), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-07-10
Taxon:
Homo sapiens (human)
Gene:
MARCHF10 (162333)
Length:
3405
CDS:
404..2803

Additional Resources:

NCBI RefSeq record:
NM_001288780.2
NBCI Gene record:
MARCHF10 (162333)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001288780.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073216 CAAGGTCATCTATCAAGATAT pLKO.1 645 CDS 100% 13.200 9.240 N MARCHF10 n/a
2 TRCN0000430788 CTAAATCCACAGGGCAATTTG pLKO_005 2090 CDS 100% 13.200 9.240 N MARCHF10 n/a
3 TRCN0000433197 GAAGCAGAAGATACTACTTTA pLKO_005 2027 CDS 100% 13.200 9.240 N MARCHF10 n/a
4 TRCN0000414976 GCCAAACCTGAGGAGATTTAC pLKO_005 820 CDS 100% 13.200 9.240 N MARCHF10 n/a
5 TRCN0000419203 GGGCCAAGAAAGGCATCATTT pLKO_005 1187 CDS 100% 13.200 9.240 N MARCHF10 n/a
6 TRCN0000426473 GTAAACAGTGCACACGAATTT pLKO_005 1997 CDS 100% 13.200 9.240 N MARCHF10 n/a
7 TRCN0000073214 CCTGGGTGACTTTAACATGAT pLKO.1 2563 CDS 100% 4.950 3.465 N MARCHF10 n/a
8 TRCN0000073215 GCATTTAAGTGTGACTCCAAA pLKO.1 668 CDS 100% 4.950 3.465 N MARCHF10 n/a
9 TRCN0000073217 GCACCCATGATTCTGAAGGAT pLKO.1 1695 CDS 100% 3.000 1.800 N MARCHF10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001288780.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14419 pDONR223 100% 81.8% 81.7% None (many diffs) n/a
2 ccsbBroad304_14419 pLX_304 0% 81.8% 81.7% V5 (many diffs) n/a
Download CSV