Transcript: Human NM_001289107.2

Homo sapiens ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 1 (ST6GALNAC1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
ST6GALNAC1 (55808)
Length:
2626
CDS:
653..2059

Additional Resources:

NCBI RefSeq record:
NM_001289107.2
NBCI Gene record:
ST6GALNAC1 (55808)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001289107.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035527 GCTTATGAATCAGACGGTGAT pLKO.1 1627 CDS 100% 4.050 5.670 N ST6GALNAC1 n/a
2 TRCN0000035524 GCTCTCATTAAAGGCTACGAA pLKO.1 1439 CDS 100% 3.000 4.200 N ST6GALNAC1 n/a
3 TRCN0000035525 CCCAGACTTTCTCCGATACAT pLKO.1 1732 CDS 100% 5.625 4.500 N ST6GALNAC1 n/a
4 TRCN0000373655 GTGAAATCTTGAAGGTATTAC pLKO_005 2434 3UTR 100% 13.200 9.240 N ST6GALNAC1 n/a
5 TRCN0000373583 CTGACTCTGTGAAGATCAAAG pLKO_005 1095 CDS 100% 10.800 7.560 N ST6GALNAC1 n/a
6 TRCN0000373584 GGACATCCTTCTACGGCTTTA pLKO_005 1476 CDS 100% 10.800 7.560 N ST6GALNAC1 n/a
7 TRCN0000035528 GCACAGAGAACATTAAAGAAA pLKO.1 396 5UTR 100% 5.625 3.938 N ST6GALNAC1 n/a
8 TRCN0000035526 CCAGAAACTCTTTCTGCCCAA pLKO.1 1135 CDS 100% 0.216 0.151 N ST6GALNAC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001289107.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12277 pDONR223 100% 56.3% 48.1% None (many diffs) n/a
2 ccsbBroad304_12277 pLX_304 0% 56.3% 48.1% V5 (many diffs) n/a
Download CSV