Transcript: Human NM_001289162.2

Homo sapiens dynein regulatory complex subunit 7 (DRC7), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
DRC7 (84229)
Length:
3387
CDS:
216..2840

Additional Resources:

NCBI RefSeq record:
NM_001289162.2
NBCI Gene record:
DRC7 (84229)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001289162.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000138596 CACTCGTACAAGTCCATGCAA pLKO.1 1755 CDS 100% 3.000 4.200 N DRC7 n/a
2 TRCN0000136088 GAAGGAGGAAATCACCTTAAA pLKO.1 329 CDS 100% 13.200 9.240 N DRC7 n/a
3 TRCN0000137180 GCTGGAGCTGAAACACATAAA pLKO.1 1673 CDS 100% 13.200 9.240 N DRC7 n/a
4 TRCN0000136503 CAAAGGCAACAAGATCATCAT pLKO.1 2141 CDS 100% 4.950 3.465 N DRC7 n/a
5 TRCN0000138281 CACTGTGCTCAAGTACCAGAA pLKO.1 743 CDS 100% 4.050 2.835 N DRC7 n/a
6 TRCN0000137421 GAACTTCTTCATCGACCCATT pLKO.1 1163 CDS 100% 4.050 2.835 N DRC7 n/a
7 TRCN0000138945 GAAGAAGACGACAGTGGGATA pLKO.1 1374 CDS 100% 4.050 2.835 N DRC7 n/a
8 TRCN0000137798 GCCAGAGAAAGGAAACCTCTT pLKO.1 2869 3UTR 100% 4.050 2.835 N DRC7 n/a
9 TRCN0000138311 CATCTATGACACCAAGCGGAA pLKO.1 2360 CDS 100% 2.160 1.512 N DRC7 n/a
10 TRCN0000136054 GAATGAGAAGAGCAAGGAATA pLKO.1 2378 CDS 100% 10.800 6.480 N DRC7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001289162.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.