Transcript: Human NM_001289397.2

Homo sapiens SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 (SMARCA2), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
SMARCA2 (6595)
Length:
5520
CDS:
95..4639

Additional Resources:

NCBI RefSeq record:
NM_001289397.2
NBCI Gene record:
SMARCA2 (6595)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001289397.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000367881 TTCTATGGGTGGGTCTAATTT pLKO_005 4920 3UTR 100% 15.000 21.000 N SMARCA2 n/a
2 TRCN0000020333 CGGAATCTTAGCCGATGAAAT pLKO.1 2326 CDS 100% 13.200 18.480 N SMARCA2 n/a
3 TRCN0000330380 GGCGTCTACATAAGGTGTTAA pLKO_005 2727 CDS 100% 13.200 18.480 N SMARCA2 n/a
4 TRCN0000358828 GGCCATCGAAGACGGCAATTT pLKO_005 3901 CDS 100% 13.200 10.560 N SMARCA2 n/a
5 TRCN0000020331 CGACTCTATCTAACTGGACAT pLKO.1 2442 CDS 100% 4.050 3.240 N SMARCA2 n/a
6 TRCN0000330445 CTATATCATCATCGTCTATAA pLKO_005 4738 3UTR 100% 13.200 9.240 N SMARCA2 n/a
7 TRCN0000020330 CCACCAGATTTAAGAACCAAA pLKO.1 1199 CDS 100% 4.950 3.465 N SMARCA2 n/a
8 TRCN0000020332 CCAAACCTGTAGTGAGCGATT pLKO.1 4554 CDS 100% 4.050 2.835 N SMARCA2 n/a
9 TRCN0000330444 CCAAACCTGTAGTGAGCGATT pLKO_005 4554 CDS 100% 4.050 2.835 N SMARCA2 n/a
10 TRCN0000358827 TGACCATCATGGAGGATTATT pLKO_005 3156 CDS 100% 15.000 9.000 N SMARCA2 n/a
11 TRCN0000020329 GCTGAGAAACTGTCACCAAAT pLKO.1 4037 CDS 100% 10.800 6.480 N SMARCA2 n/a
12 TRCN0000330443 GCTGAGAAACTGTCACCAAAT pLKO_005 4037 CDS 100% 10.800 6.480 N SMARCA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001289397.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11145 pDONR223 100% 7.8% 7.8% None 1_4185del n/a
2 ccsbBroad304_11145 pLX_304 0% 7.8% 7.8% V5 1_4185del n/a
Download CSV