Transcript: Mouse NM_001289436.1

Mus musculus coiled-coil domain containing 50 (Ccdc50), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Ccdc50 (67501)
Length:
7063
CDS:
630..1097

Additional Resources:

NCBI RefSeq record:
NM_001289436.1
NBCI Gene record:
Ccdc50 (67501)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001289436.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000146450 CGACTTCTAATGGCTGAAGAA pLKO.1 798 CDS 100% 4.950 3.960 N CCDC50 n/a
2 TRCN0000184277 GCACAGTACAACATGGCATCT pLKO.1 1031 CDS 100% 4.050 3.240 N Ccdc50 n/a
3 TRCN0000180733 GCAGCTGCTTTGCTGTTTATT pLKO.1 1521 3UTR 100% 15.000 10.500 N Ccdc50 n/a
4 TRCN0000328993 GCAGCTGCTTTGCTGTTTATT pLKO_005 1521 3UTR 100% 15.000 10.500 N Ccdc50 n/a
5 TRCN0000375162 ACAAGAGATTGAGCATCATTT pLKO_005 238 5UTR 100% 13.200 9.240 N Ccdc50 n/a
6 TRCN0000375161 GGAAATTGCTCGACTTCTAAT pLKO_005 788 CDS 100% 13.200 9.240 N Ccdc50 n/a
7 TRCN0000328929 AGCTCCAGAAGCGCTACAAAG pLKO_005 348 5UTR 100% 10.800 7.560 N Ccdc50 n/a
8 TRCN0000180106 CATGACCCTGAATGCAAGTTA pLKO.1 876 CDS 100% 5.625 3.938 N Ccdc50 n/a
9 TRCN0000328991 CATGACCCTGAATGCAAGTTA pLKO_005 876 CDS 100% 5.625 3.938 N Ccdc50 n/a
10 TRCN0000184397 CCAAGATTGACAGGCCATCAA pLKO.1 949 CDS 100% 4.950 3.465 N Ccdc50 n/a
11 TRCN0000129948 GAACAAGAGATTGAGCATCAT pLKO.1 236 5UTR 100% 4.950 3.465 N CCDC50 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001289436.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.