Transcript: Mouse NM_001289633.1

Mus musculus inter alpha-trypsin inhibitor, heavy chain 4 (Itih4), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Itih4 (16427)
Length:
3044
CDS:
54..2762

Additional Resources:

NCBI RefSeq record:
NM_001289633.1
NBCI Gene record:
Itih4 (16427)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001289633.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000087654 CGGATCTATGTCAGGCAAGAA pLKO.1 899 CDS 100% 4.950 6.930 N Itih4 n/a
2 TRCN0000087657 GCAAGCGACAGAAGAGAATTT pLKO.1 1034 CDS 100% 13.200 9.240 N Itih4 n/a
3 TRCN0000087656 CCTTCCTACAATGTCCAAGAA pLKO.1 854 CDS 100% 4.950 3.465 N Itih4 n/a
4 TRCN0000087655 GCCCAACAAGAGAAGGAGTTT pLKO.1 1632 CDS 100% 4.950 3.465 N Itih4 n/a
5 TRCN0000087653 CCCTGCCATGTTGTCCTCGTA pLKO.1 2782 3UTR 100% 0.880 0.616 N Itih4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001289633.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.