Transcript: Human NM_001289905.1

Homo sapiens interleukin 17 receptor A (IL17RA), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
IL17RA (23765)
Length:
8506
CDS:
134..2632

Additional Resources:

NCBI RefSeq record:
NM_001289905.1
NBCI Gene record:
IL17RA (23765)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001289905.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059155 CGACTGGTTCGAATGTGAGAA pLKO.1 1777 CDS 100% 4.950 6.930 N IL17RA n/a
2 TRCN0000059157 GCTAAACTGCACGGTCAAGAA pLKO.1 274 CDS 100% 4.950 6.930 N IL17RA n/a
3 TRCN0000059154 GCTGAACACCAATGAACGTTT pLKO.1 487 CDS 100% 4.950 6.930 N IL17RA n/a
4 TRCN0000059153 GTGGAACGAATCTACCCATTA pLKO.1 802 CDS 100% 10.800 8.640 N IL17RA n/a
5 TRCN0000432491 TTCGTTCATTCAGCATTTATT pLKO_005 2892 3UTR 100% 15.000 10.500 N IL17RA n/a
6 TRCN0000436504 GCGGTCTGGTTATCGTCTATC pLKO_005 2807 3UTR 100% 10.800 7.560 N IL17RA n/a
7 TRCN0000059156 CCACAGTTGCTTTGAGCACAT pLKO.1 859 CDS 100% 4.050 2.430 N IL17RA n/a
8 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 3213 3UTR 100% 10.800 5.400 Y SMIM11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001289905.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.