Transcript: Human NM_001290321.2

Homo sapiens Dmx like 1 (DMXL1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-02-24
Taxon:
Homo sapiens (human)
Gene:
DMXL1 (1657)
Length:
11549
CDS:
484..9630

Additional Resources:

NCBI RefSeq record:
NM_001290321.2
NBCI Gene record:
DMXL1 (1657)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001290321.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149383 GCAGCGTCTTATGGAAATGTT pLKO.1 700 CDS 100% 5.625 7.875 N DMXL1 n/a
2 TRCN0000146906 CCAATCCATTATTGCACCTTA pLKO.1 7067 CDS 100% 4.950 6.930 N DMXL1 n/a
3 TRCN0000148258 GATAGCAATTTAGTGGCCTAT pLKO.1 3820 CDS 100% 4.050 5.670 N DMXL1 n/a
4 TRCN0000150026 CGTACTTTATCTACTGGCTAT pLKO.1 6607 CDS 100% 4.050 3.240 N DMXL1 n/a
5 TRCN0000242011 AGTAGTTGCCAATCCATTATT pLKO_005 7059 CDS 100% 15.000 10.500 N Dmxl1 n/a
6 TRCN0000418635 AGTAGTTGCCAATCCATTATT pLKO_005 7059 CDS 100% 15.000 10.500 N DMXL1 n/a
7 TRCN0000428369 GATATTCTCCATGCCATAATA pLKO_005 7102 CDS 100% 15.000 10.500 N DMXL1 n/a
8 TRCN0000149836 CCAGATCAGTTTAGCCCTTTA pLKO.1 9571 CDS 100% 10.800 7.560 N DMXL1 n/a
9 TRCN0000149286 GCTTCCAGTAAAGAACGAGTT pLKO.1 1381 CDS 100% 4.050 2.835 N DMXL1 n/a
10 TRCN0000149769 GCACACAATATAACCTGGGAT pLKO.1 820 CDS 100% 2.640 1.848 N DMXL1 n/a
11 TRCN0000420049 GTTGATGCTGATGGATATTTA pLKO_005 8959 CDS 100% 15.000 9.000 N DMXL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001290321.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.