Transcript: Mouse NM_001290652.1

Mus musculus sex comb on midleg-like 2 (Drosophila) (Scml2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Scml2 (107815)
Length:
4701
CDS:
524..3061

Additional Resources:

NCBI RefSeq record:
NM_001290652.1
NBCI Gene record:
Scml2 (107815)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001290652.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098161 CCCATGTTCTTACTACGTGTA pLKO.1 878 CDS 100% 4.050 5.670 N Scml2 n/a
2 TRCN0000098164 CCCTAAGAAGGGCATTACTAT pLKO.1 2374 CDS 100% 5.625 3.938 N Scml2 n/a
3 TRCN0000098162 CCTCTGAACAACCAAAGTCTT pLKO.1 2214 CDS 100% 4.950 3.465 N Scml2 n/a
4 TRCN0000098163 GCAGTGTTCTTTAAGGAGGAA pLKO.1 923 CDS 100% 2.640 1.848 N Scml2 n/a
5 TRCN0000098160 GCCTTCTTTGATGGGAAAGTT pLKO.1 2759 CDS 100% 5.625 3.375 N Scml2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001290652.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.