Transcript: Mouse NM_001290682.1

Mus musculus potassium voltage gated channel, Shaw-related subfamily, member 3 (Kcnc3), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Kcnc3 (16504)
Length:
5184
CDS:
1..2277

Additional Resources:

NCBI RefSeq record:
NM_001290682.1
NBCI Gene record:
Kcnc3 (16504)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001290682.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069462 CAGCGGTAAGATCGTGATCAA pLKO.1 264 CDS 100% 4.950 6.930 N Kcnc3 n/a
2 TRCN0000069458 GCATGTACTATTCACTGGCTA pLKO.1 1631 CDS 100% 2.640 3.696 N Kcnc3 n/a
3 TRCN0000069459 CGAATTCTTGTTACTCATCAT pLKO.1 1341 CDS 100% 0.000 0.000 N Kcnc3 n/a
4 TRCN0000069460 TGCCCAGATAAGGTGGAGTTT pLKO.1 1111 CDS 100% 4.950 3.960 N Kcnc3 n/a
5 TRCN0000044910 CTCCAACCACACCTACTTCAA pLKO.1 1446 CDS 100% 4.950 3.465 N KCNC3 n/a
6 TRCN0000069461 CTCCCTATTCTTTATCCTCAT pLKO.1 888 CDS 100% 4.050 2.835 N Kcnc3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001290682.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.