Transcript: Mouse NM_001290697.1

Mus musculus NudC domain containing 2 (Nudcd2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Nudcd2 (52653)
Length:
1524
CDS:
306..704

Additional Resources:

NCBI RefSeq record:
NM_001290697.1
NBCI Gene record:
Nudcd2 (52653)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001290697.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000191306 CAATTGCTGATGAAGGAACAT pLKO.1 514 CDS 100% 4.950 6.930 N Nudcd2 n/a
2 TRCN0000200651 CCTAAGTGATTATGTCAAGAA pLKO.1 1222 3UTR 100% 4.950 3.465 N Nudcd2 n/a
3 TRCN0000201327 GCAAGACCAAATGCAGAGAAA pLKO.1 572 CDS 100% 4.950 3.465 N Nudcd2 n/a
4 TRCN0000155178 GAGGAGGTGTTCATTGAAGTT pLKO.1 381 CDS 100% 4.950 3.465 N NUDCD2 n/a
5 TRCN0000157671 GTGGAGCAGAAATCTCAGGAA pLKO.1 640 CDS 100% 2.640 1.848 N NUDCD2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001290697.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04893 pDONR223 100% 76.4% 83.4% None (many diffs) n/a
2 ccsbBroad304_04893 pLX_304 0% 76.4% 83.4% V5 (many diffs) n/a
Download CSV