Transcript: Mouse NM_001290785.1

Mus musculus Sec24 related gene family, member A (S. cerevisiae) (Sec24a), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Sec24a (77371)
Length:
6795
CDS:
662..3931

Additional Resources:

NCBI RefSeq record:
NM_001290785.1
NBCI Gene record:
Sec24a (77371)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001290785.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000379503 TACGTCTAGATGAACGAATTT pLKO_005 3402 CDS 100% 13.200 18.480 N Sec24a n/a
2 TRCN0000253656 TCCCTTAGGTGCTAATCATTT pLKO_005 1633 CDS 100% 13.200 18.480 N SEC24A n/a
3 TRCN0000413636 ACTTATGTTATCGAGTCAATG pLKO_005 2007 CDS 100% 10.800 15.120 N Sec24a n/a
4 TRCN0000100527 CGGATCATCAATATGTTTCTT pLKO.1 1164 CDS 100% 5.625 7.875 N Sec24a n/a
5 TRCN0000100529 GCGGCTCATAATACTTATGAT pLKO.1 1427 CDS 100% 0.563 0.788 N Sec24a n/a
6 TRCN0000423158 CGTCAACTTCCTTGATCAAAG pLKO_005 1972 CDS 100% 10.800 8.640 N Sec24a n/a
7 TRCN0000100526 CGCAATAGAAACTGGATACTT pLKO.1 2194 CDS 100% 5.625 4.500 N Sec24a n/a
8 TRCN0000100525 CCTCCTTAAGATTGTGAACAA pLKO.1 3974 3UTR 100% 4.950 3.960 N Sec24a n/a
9 TRCN0000100528 GCAGGCTCATTACTGATGCTT pLKO.1 3611 CDS 100% 3.000 2.400 N Sec24a n/a
10 TRCN0000412660 ATGGATTGAGATGAGACAATA pLKO_005 4170 3UTR 100% 13.200 9.240 N Sec24a n/a
11 TRCN0000380077 TGTCAATCAGGAAGGTATTAC pLKO_005 1381 CDS 100% 13.200 9.240 N Sec24a n/a
12 TRCN0000427678 CTCACTCGGAAGATTGGATTT pLKO_005 2864 CDS 100% 10.800 7.560 N Sec24a n/a
13 TRCN0000379790 GAAGTCCAGAATGCTACTATT pLKO_005 2093 CDS 100% 13.200 7.920 N Sec24a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001290785.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.