Transcript: Mouse NM_001290826.1

Mus musculus cytoplasmic polyadenylation element binding protein 3 (Cpeb3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Cpeb3 (208922)
Length:
6259
CDS:
540..2690

Additional Resources:

NCBI RefSeq record:
NM_001290826.1
NBCI Gene record:
Cpeb3 (208922)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001290826.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000240701 ACGCTTTCCGGACCGATAATG pLKO_005 1504 CDS 100% 13.200 18.480 N CPEB3 n/a
2 TRCN0000240699 ACTCCTTAATGGATATGATAA pLKO_005 1594 CDS 100% 13.200 18.480 N CPEB3 n/a
3 TRCN0000190074 GCAAATCGTACTTCCCTCCTA pLKO.1 2023 CDS 100% 2.640 3.696 N Cpeb3 n/a
4 TRCN0000240700 ACCAATGAGTTTCGCTGATAT pLKO_005 1664 CDS 100% 13.200 9.240 N CPEB3 n/a
5 TRCN0000201130 CAACTTCAACACAACGACATT pLKO.1 2433 CDS 100% 4.950 3.465 N Cpeb3 n/a
6 TRCN0000201960 CGTGTTGTCGTTGCTCTGATT pLKO.1 3046 3UTR 100% 4.950 3.465 N Cpeb3 n/a
7 TRCN0000201870 GCAGAATCACAGAGTGTGTAA pLKO.1 2877 3UTR 100% 4.950 3.465 N Cpeb3 n/a
8 TRCN0000147484 GCTGATATAATGTGGAGGAAT pLKO.1 1677 CDS 100% 4.950 3.465 N CPEB3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001290826.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.