Transcript: Mouse NM_001290992.1

Mus musculus CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2 (Ctdspl2), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Ctdspl2 (329506)
Length:
6733
CDS:
980..2035

Additional Resources:

NCBI RefSeq record:
NM_001290992.1
NBCI Gene record:
Ctdspl2 (329506)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001290992.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216375 GTGTACAAGGAAACTATATAA pLKO.1 1776 CDS 100% 15.000 21.000 N Ctdspl2 n/a
2 TRCN0000193244 CAGATTTCGATTGCATGATTT pLKO.1 1999 CDS 100% 13.200 18.480 N Ctdspl2 n/a
3 TRCN0000216013 CCCTATAGAAAGCTGGTTTAT pLKO.1 1888 CDS 100% 13.200 18.480 N Ctdspl2 n/a
4 TRCN0000160759 CGGAGTAGAATTGAACGTGAT pLKO.1 848 5UTR 100% 4.050 5.670 N CTDSPL2 n/a
5 TRCN0000158961 GCTTACTCAAATCAAGCAGTT pLKO.1 1229 CDS 100% 4.050 5.670 N CTDSPL2 n/a
6 TRCN0000193536 GCCCAATAATAATCAAGGGTT pLKO.1 2165 3UTR 100% 2.640 3.696 N Ctdspl2 n/a
7 TRCN0000134621 GCTTTCTAATGGAATCCCTAT pLKO.1 1873 CDS 100% 4.050 3.240 N CTDSPL2 n/a
8 TRCN0000216454 GGCTTATTGTCTTCAATTAAA pLKO.1 780 5UTR 100% 15.000 10.500 N Ctdspl2 n/a
9 TRCN0000160016 CTTTCTAATGGAATCCCTATA pLKO.1 1874 CDS 100% 10.800 7.560 N CTDSPL2 n/a
10 TRCN0000174334 CAGATGTATGAGATCATTCTT pLKO.1 1655 CDS 100% 5.625 3.938 N Ctdspl2 n/a
11 TRCN0000164548 CCTGGAACGAATGTCTCAGAT pLKO.1 1639 CDS 100% 4.950 3.465 N CTDSPL2 n/a
12 TRCN0000174654 GCCATCACTAAATAATGGTTT pLKO.1 1258 CDS 100% 4.950 3.465 N Ctdspl2 n/a
13 TRCN0000175943 GCTCCCAGTTACAATCAGTTT pLKO.1 3055 3UTR 100% 4.950 3.465 N Ctdspl2 n/a
14 TRCN0000136623 GCTTCTAAGAAGGTGTATGCA pLKO.1 1682 CDS 100% 3.000 2.100 N CTDSPL2 n/a
15 TRCN0000193964 GCTGAGGAGATAGTGAAACAA pLKO.1 1151 CDS 100% 5.625 3.375 N Ctdspl2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001290992.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.