Transcript: Mouse NM_001291176.1

Mus musculus nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 2 (Nfatc2), transcript variant 13, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Nfatc2 (18019)
Length:
5809
CDS:
489..1910

Additional Resources:

NCBI RefSeq record:
NM_001291176.1
NBCI Gene record:
Nfatc2 (18019)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001291176.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245134 CCAGATCAGTATGGTATTAAA pLKO_005 4239 3UTR 100% 15.000 21.000 N Nfatc2 n/a
2 TRCN0000245130 TTTCCATCCTCTTCGATTATG pLKO_005 263 5UTR 100% 13.200 10.560 N Nfatc2 n/a
3 TRCN0000012356 GCCCGTGAAAGTCAACTTCTA pLKO.1 1100 CDS 100% 4.950 3.960 N Nfatc2 n/a
4 TRCN0000245133 ATGGAAGCTACGGTGGATAAA pLKO_005 1014 CDS 100% 13.200 9.240 N Nfatc2 n/a
5 TRCN0000012353 CCCACAGACATGGCTTCATTT pLKO.1 2282 3UTR 100% 13.200 9.240 N Nfatc2 n/a
6 TRCN0000012354 GCGATGAGTATGAACCATCTT pLKO.1 1201 CDS 100% 4.950 3.465 N Nfatc2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001291176.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.