Transcript: Mouse NM_001291268.1

Mus musculus HNF1 homeobox B (Hnf1b), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Hnf1b (21410)
Length:
2765
CDS:
181..1779

Additional Resources:

NCBI RefSeq record:
NM_001291268.1
NBCI Gene record:
Hnf1b (21410)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001291268.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000225725 ACACTCCTCCCATCCTCAAAG pLKO_005 440 CDS 100% 10.800 15.120 N Hnf1b n/a
2 TRCN0000055294 GCAATCTCAGAACCTCATCAT pLKO.1 1389 CDS 100% 4.950 6.930 N Hnf1b n/a
3 TRCN0000055296 CGACTATGACACTCCTCCCAT pLKO.1 432 CDS 100% 2.640 3.696 N Hnf1b n/a
4 TRCN0000225728 CCAATGGGTGTAAACTATAAA pLKO_005 2255 3UTR 100% 15.000 12.000 N Hnf1b n/a
5 TRCN0000218718 GATACATGCAACAGCACAATA pLKO_005 560 CDS 100% 13.200 10.560 N Hnf1b n/a
6 TRCN0000225727 AGCCTGGTGATACTCACATAA pLKO_005 1770 CDS 100% 13.200 9.240 N Hnf1b n/a
7 TRCN0000225726 GTCACTTCCTCTTCGACAATC pLKO_005 1180 CDS 100% 10.800 7.560 N Hnf1b n/a
8 TRCN0000255582 TGCAATGGTGGTCACAGATAC pLKO_005 1695 CDS 100% 10.800 7.560 N HNF1B n/a
9 TRCN0000055295 GCTACAGAACTCCCACATGTA pLKO.1 1623 CDS 100% 4.950 3.465 N Hnf1b n/a
10 TRCN0000055297 CGACAATCAGTCACCATGGTA pLKO.1 1193 CDS 100% 3.000 2.100 N Hnf1b n/a
11 TRCN0000055293 CGGTCATTAACAGTGTGGCTA pLKO.1 1475 CDS 100% 2.640 1.848 N Hnf1b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001291268.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.