Transcript: Mouse NM_001291271.1

Mus musculus mitochondrial ribosomal protein S23 (Mrps23), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Mrps23 (64656)
Length:
1576
CDS:
340..816

Additional Resources:

NCBI RefSeq record:
NM_001291271.1
NBCI Gene record:
Mrps23 (64656)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001291271.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000247734 GCTCATAGGCTGCCTAGAAAT pLKO_005 1359 3UTR 100% 13.200 18.480 N Mrps23 n/a
2 TRCN0000247733 GGATCAGATTCGAGCGAAATT pLKO_005 483 CDS 100% 13.200 18.480 N Mrps23 n/a
3 TRCN0000232963 ACAGATGAAGAGAAGTTATTT pLKO_005 616 CDS 100% 15.000 12.000 N MRPS23 n/a
4 TRCN0000247731 ACAGATGAAGAGAAGTTATTT pLKO_005 616 CDS 100% 15.000 12.000 N Mrps23 n/a
5 TRCN0000247735 TGTTGGCAGAAGGCATCATTT pLKO_005 656 CDS 100% 13.200 9.240 N Mrps23 n/a
6 TRCN0000247732 CCTATGGATCTGGTCAGAAAG pLKO_005 512 CDS 100% 10.800 7.560 N Mrps23 n/a
7 TRCN0000153206 CCAAACTTCAAGTCTACCTGT pLKO.1 550 CDS 100% 2.640 1.848 N MRPS23 n/a
8 TRCN0000184421 GCATCTGAACTCTTTGGGCTT pLKO.1 1093 3UTR 100% 2.160 1.512 N Mrps23 n/a
9 TRCN0000195979 CAAAGCTGACATCCAGGACAT pLKO.1 450 CDS 100% 4.050 2.430 N Mrps23 n/a
10 TRCN0000155591 CGGTTTGTGGAGAAGTACACT pLKO.1 574 CDS 100% 3.000 2.100 N MRPS23 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001291271.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.