Transcript: Human NM_001291309.1

Homo sapiens proprotein convertase subtilisin/kexin type 6 (PCSK6), transcript variant 9, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
PCSK6 (5046)
Length:
4349
CDS:
315..3002

Additional Resources:

NCBI RefSeq record:
NM_001291309.1
NBCI Gene record:
PCSK6 (5046)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001291309.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425553 GACGTGAACGGCAATGATTAT pLKO_005 990 CDS 100% 13.200 18.480 N PCSK6 n/a
2 TRCN0000438565 GTCGAAGGTGTGACGAGAACT pLKO_005 2785 CDS 100% 4.950 6.930 N PCSK6 n/a
3 TRCN0000075249 GCGTGGATGAACCTGAGAAAT pLKO.1 2512 CDS 100% 13.200 10.560 N PCSK6 n/a
4 TRCN0000455025 AGCAACGCTGACGAGACATTC pLKO_005 2898 CDS 100% 10.800 7.560 N PCSK6 n/a
5 TRCN0000444278 AGGGCAGTGGACCTTGGAAAT pLKO_005 1889 CDS 100% 10.800 7.560 N PCSK6 n/a
6 TRCN0000075250 CCTGGAAGATTACTACCATTT pLKO.1 620 CDS 100% 10.800 7.560 N PCSK6 n/a
7 TRCN0000437296 GCGAACGGAAGCTCTTCATTC pLKO_005 2947 CDS 100% 10.800 7.560 N PCSK6 n/a
8 TRCN0000427842 GGAAGATTACACAGCTCAATC pLKO_005 2117 CDS 100% 10.800 7.560 N PCSK6 n/a
9 TRCN0000075252 GAGTGCATTCACTGTGCGAAA pLKO.1 2676 CDS 100% 4.050 2.835 N PCSK6 n/a
10 TRCN0000431667 GCTTTCGAGTATGGCATTAAA pLKO_005 1287 CDS 100% 15.000 9.000 N PCSK6 n/a
11 TRCN0000075251 CCACGATATGATGCCAGCAAT pLKO.1 1020 CDS 100% 4.950 2.970 N PCSK6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001291309.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.