Transcript: Human NM_001292006.2

Homo sapiens kelch like family member 8 (KLHL8), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
KLHL8 (57563)
Length:
5403
CDS:
353..1987

Additional Resources:

NCBI RefSeq record:
NM_001292006.2
NBCI Gene record:
KLHL8 (57563)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001292006.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000141078 CGAAGCAACAAGTGGGATTAT pLKO.1 1712 CDS 100% 13.200 18.480 N KLHL8 n/a
2 TRCN0000144444 CGCAGTATTGAATGCTATTCT pLKO.1 1124 CDS 100% 5.625 7.875 N KLHL8 n/a
3 TRCN0000142312 GTGGTCATAATGGCAATGCAT pLKO.1 1803 CDS 100% 3.000 4.200 N KLHL8 n/a
4 TRCN0000140737 GACTTAATGGACATGGCGGAT pLKO.1 671 CDS 100% 2.160 3.024 N KLHL8 n/a
5 TRCN0000145060 CCTGACTTTGAATACTCCATT pLKO.1 1028 CDS 100% 4.950 3.465 N KLHL8 n/a
6 TRCN0000140484 GAACACAAAGAGGCGAGGAAT pLKO.1 1321 CDS 100% 4.950 3.465 N KLHL8 n/a
7 TRCN0000144983 GCCACCAACAATTTAGTCATA pLKO.1 1999 3UTR 100% 4.950 3.465 N KLHL8 n/a
8 TRCN0000145471 GAAGGTAAAGTGTATGCAGTA pLKO.1 1217 CDS 100% 4.050 2.835 N KLHL8 n/a
9 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 4260 3UTR 100% 4.950 2.475 Y ORAI2 n/a
10 TRCN0000136653 GCCTGACCAACATGGTGAAAT pLKO.1 4250 3UTR 100% 13.200 6.600 Y IQCC n/a
11 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 4348 3UTR 100% 10.800 5.400 Y SMIM11A n/a
12 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 4257 3UTR 100% 4.950 2.475 Y LOC339059 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001292006.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.