Transcript: Mouse NM_001293561.1

Mus musculus unc-5 netrin receptor C (Unc5c), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Unc5c (22253)
Length:
9355
CDS:
151..3003

Additional Resources:

NCBI RefSeq record:
NM_001293561.1
NBCI Gene record:
Unc5c (22253)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001293561.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000376866 CTGTCCATGGCTCGTTCTATT pLKO_005 3394 3UTR 100% 13.200 18.480 N Unc5c n/a
2 TRCN0000366902 ATCGAGCCCAACTGGCGTAAT pLKO_005 2862 CDS 100% 10.800 15.120 N Unc5c n/a
3 TRCN0000433177 TGGCGTAATCCTGGATCTTTG pLKO_005 2874 CDS 100% 10.800 8.640 N UNC5C n/a
4 TRCN0000071904 CGTCTTAAACTGGCCATCTTT pLKO.1 2248 CDS 100% 5.625 4.500 N Unc5c n/a
5 TRCN0000366903 ATGAAACCTCTGGTCTAATTG pLKO_005 485 CDS 100% 13.200 9.240 N Unc5c n/a
6 TRCN0000071905 GCCGCTCAAGATGATGAATTT pLKO.1 265 CDS 100% 13.200 9.240 N Unc5c n/a
7 TRCN0000375973 CAGCCACTGTCATCGTGTATG pLKO_005 905 CDS 100% 10.800 7.560 N Unc5c n/a
8 TRCN0000071906 CCAATGACCAACTCTCCAATT pLKO.1 1597 CDS 100% 10.800 7.560 N Unc5c n/a
9 TRCN0000375972 CTAGAGAATGAGGCCCTTAAC pLKO_005 1735 CDS 100% 10.800 7.560 N Unc5c n/a
10 TRCN0000071907 GCTGGCTAAGTATCAGGAAAT pLKO.1 2478 CDS 100% 10.800 7.560 N Unc5c n/a
11 TRCN0000071903 CCTGCTGAAGATCGGAACTTT pLKO.1 778 CDS 100% 5.625 3.375 N Unc5c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001293561.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.