Transcript: Mouse NM_001293637.1

Mus musculus NIMA (never in mitosis gene a)-related expressed kinase 1 (Nek1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Nek1 (18004)
Length:
5635
CDS:
603..4430

Additional Resources:

NCBI RefSeq record:
NM_001293637.1
NBCI Gene record:
Nek1 (18004)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001146251 GCATTTGGTCAAAAATGGCA pXPR_003 TGG 1340 35% 16 -0.1367 Nek1 NEK1 76125
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001293637.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254175 CGGAGTGCCTTTAACATATAA pLKO_005 1547 CDS 100% 15.000 21.000 N Nek1 n/a
2 TRCN0000254174 CTGGAAGATGAACCAATTAAA pLKO_005 3897 CDS 100% 15.000 21.000 N Nek1 n/a
3 TRCN0000265490 TACTGTGGGAGAGGTTATTAA pLKO_005 3029 CDS 100% 15.000 21.000 N Nek1 n/a
4 TRCN0000265500 AGCGGTTGGAGAGGATAAATA pLKO_005 1786 CDS 100% 15.000 10.500 N Nek1 n/a
5 TRCN0000382291 CCATCAGTCAACTCCATATTG pLKO_005 1341 CDS 100% 13.200 9.240 N NEK1 n/a
6 TRCN0000021582 CGCCAACAGATTAAAGCCAAA pLKO.1 2397 CDS 100% 4.050 2.835 N NEK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001293637.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.