Transcript: Mouse NM_001293693.1

Mus musculus a disintegrin and metallopeptidase domain 32 (Adam32), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Adam32 (353188)
Length:
2247
CDS:
10..2043

Additional Resources:

NCBI RefSeq record:
NM_001293693.1
NBCI Gene record:
Adam32 (353188)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001293693.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000087584 CGAGATTTCTTAGGGATCAAT pLKO.1 1874 CDS 100% 5.625 7.875 N Adam32 n/a
2 TRCN0000087585 CCCGAGTCTCAAAGTTCATTT pLKO.1 82 CDS 100% 13.200 9.240 N Adam32 n/a
3 TRCN0000087587 CCCTCATCAACATGCTGCAAA pLKO.1 1318 CDS 100% 4.950 3.465 N Adam32 n/a
4 TRCN0000087586 CGTATGATGAGCCTGAGAAAT pLKO.1 1001 CDS 100% 13.200 7.920 N Adam32 n/a
5 TRCN0000087583 AGGAGGAAGAGGAAGAGGAAA pLKO.1 2109 3UTR 100% 4.950 2.475 Y Adam32 n/a
6 TRCN0000156756 GAGGAAGAGGAAGAGGAAGAT pLKO.1 2111 3UTR 100% 4.950 2.475 Y NPM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001293693.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.