Transcript: Mouse NM_001293727.1

Mus musculus cingulin (Cgn), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Cgn (70737)
Length:
5015
CDS:
170..3724

Additional Resources:

NCBI RefSeq record:
NM_001293727.1
NBCI Gene record:
Cgn (70737)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001293727.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252975 GCCTTTATGAGTCCTAGTAAT pLKO_005 587 CDS 100% 13.200 18.480 N Cgn n/a
2 TRCN0000267482 TGGAGTTCAAATTCGATTTAT pLKO_005 202 CDS 100% 15.000 10.500 N Cgn n/a
3 TRCN0000252978 TAAACCGACTTCCTCGATTAA pLKO_005 637 CDS 100% 13.200 9.240 N Cgn n/a
4 TRCN0000252976 GTGAGGAGGAAAGTTAGTTTG pLKO_005 1133 CDS 100% 10.800 7.560 N Cgn n/a
5 TRCN0000252977 AGTGATGGTGATAAACTTTAG pLKO_005 3849 3UTR 100% 10.800 6.480 N Cgn n/a
6 TRCN0000005712 GCACATTCATACCTCTCCAAA pLKO.1 4385 3UTR 100% 4.950 2.475 Y CGN n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001293727.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03828 pDONR223 100% 84.4% 85.7% None (many diffs) n/a
2 ccsbBroad304_03828 pLX_304 0% 84.4% 85.7% V5 (many diffs) n/a
Download CSV