Transcript: Human NM_001294340.2

Homo sapiens zinc finger CCCH-type containing 18 (ZC3H18), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
ZC3H18 (124245)
Length:
3777
CDS:
179..3112

Additional Resources:

NCBI RefSeq record:
NM_001294340.2
NBCI Gene record:
ZC3H18 (124245)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001294340.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000233041 CCTTACGCAGACCCTTATTAT pLKO_005 1346 CDS 100% 15.000 21.000 N ZC3H18 n/a
2 TRCN0000233040 GGCGAAGACGAACGGGAATTT pLKO_005 1253 CDS 100% 13.200 18.480 N ZC3H18 n/a
3 TRCN0000233039 GGGAATGAATTGTAGGTTTAT pLKO_005 952 CDS 100% 13.200 18.480 N ZC3H18 n/a
4 TRCN0000075171 GTTGAATAAGGCGGCTGATAA pLKO.1 2710 CDS 100% 13.200 18.480 N ZC3H18 n/a
5 TRCN0000075172 CGTATCATAATTACCGAGAAA pLKO.1 1440 CDS 100% 4.950 6.930 N ZC3H18 n/a
6 TRCN0000075168 CCAGCACGGTTCTCATGTAAA pLKO.1 3346 3UTR 100% 13.200 9.240 N ZC3H18 n/a
7 TRCN0000233042 GTCAGCCTCTGCCTCTAATTC pLKO_005 1891 CDS 100% 13.200 9.240 N ZC3H18 n/a
8 TRCN0000075170 CTGTTGAATAAGGCGGCTGAT pLKO.1 2708 CDS 100% 4.050 2.835 N ZC3H18 n/a
9 TRCN0000123498 TGAAAGATGTTGTGACACCAT pLKO.1 861 CDS 100% 2.640 1.848 N Zc3h18 n/a
10 TRCN0000075169 CGCAGACCCTTATTATGACTA pLKO.1 1351 CDS 100% 4.950 2.970 N ZC3H18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001294340.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09481 pDONR223 100% 97.4% 97.4% None 474A>G;685_756del;1391G>A n/a
2 ccsbBroad304_09481 pLX_304 0% 97.4% 97.4% V5 474A>G;685_756del;1391G>A n/a
Download CSV