Transcript: Human NM_001297435.1

Homo sapiens family with sequence similarity 53 member A (FAM53A), transcript variant 3, mRNA.

Source:
NCBI, updated 2018-06-30
Taxon:
Homo sapiens (human)
Gene:
FAM53A (152877)
Length:
3361
CDS:
599..1681

Additional Resources:

NCBI RefSeq record:
NM_001297435.1
NBCI Gene record:
FAM53A (152877)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001297435.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000121931 CTTGGAACATTAAGGCGTAAT pLKO.1 2636 3UTR 100% 10.800 15.120 N FAM53A n/a
2 TRCN0000434846 GAACAAGAGCGGTCGTCTGTT pLKO_005 697 CDS 100% 4.950 6.930 N FAM53A n/a
3 TRCN0000146779 CTCAATTACGAAGATGACGAT pLKO.1 1665 CDS 100% 2.640 3.696 N FAM53A n/a
4 TRCN0000423050 GGGCACAGACTAGGTTTCATG pLKO_005 2550 3UTR 100% 4.950 6.435 N FAM53A n/a
5 TRCN0000122684 GCACAGAGTAGGTTTCGTGTT pLKO.1 2614 3UTR 100% 4.050 2.835 N FAM53A n/a
6 TRCN0000122125 GCTTGGAACATTAAGGCGTAA pLKO.1 2635 3UTR 100% 4.050 2.835 N FAM53A n/a
7 TRCN0000428146 AGGGCACAGAGTAGGTTTCCT pLKO_005 2364 3UTR 100% 3.000 2.100 N FAM53A n/a
8 TRCN0000431347 CTCACACCATGGGTCTTCAGT pLKO_005 834 CDS 100% 3.000 2.100 N FAM53A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001297435.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05068 pDONR223 100% 68.6% 76.4% None 881_1034del;1080_1081ins268 n/a
2 ccsbBroad304_05068 pLX_304 0% 68.6% 76.4% V5 881_1034del;1080_1081ins268 n/a
Download CSV