Transcript: Human NM_001297755.1

Homo sapiens helicase, POLQ like (HELQ), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-07-15
Taxon:
Homo sapiens (human)
Gene:
HELQ (113510)
Length:
3422
CDS:
191..3295

Additional Resources:

NCBI RefSeq record:
NM_001297755.1
NBCI Gene record:
HELQ (113510)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001297755.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434179 ACGTTGTCAACAGGCTATATC pLKO_005 2778 CDS 100% 13.200 18.480 N HELQ n/a
2 TRCN0000421485 CGTAAGGACAATTGATCATTT pLKO_005 3127 CDS 100% 13.200 18.480 N HELQ n/a
3 TRCN0000051561 CCCTGATTGGATGATATACTT pLKO.1 2638 CDS 100% 5.625 7.875 N HELQ n/a
4 TRCN0000051562 GCAACCTTACTGAATTACAAA pLKO.1 678 CDS 100% 5.625 7.875 N HELQ n/a
5 TRCN0000422048 ATTGGTATGAGTGCAACATTA pLKO_005 1469 CDS 100% 13.200 9.240 N HELQ n/a
6 TRCN0000051559 GCAGAACTCTTCAAATGATTT pLKO.1 808 CDS 100% 13.200 9.240 N HELQ n/a
7 TRCN0000424253 GGATATGAAGGTGTCACTATT pLKO_005 725 CDS 100% 13.200 9.240 N HELQ n/a
8 TRCN0000417123 TCTTGATGACATCTATCATTT pLKO_005 2296 CDS 100% 13.200 9.240 N HELQ n/a
9 TRCN0000421264 TGCTCAAAGAGACCAACATTT pLKO_005 2820 CDS 100% 13.200 9.240 N HELQ n/a
10 TRCN0000435551 AGTCTAATGCACTTAGCTAAT pLKO_005 3089 CDS 100% 10.800 7.560 N HELQ n/a
11 TRCN0000426342 TTGGTGACTATGATAGCTTTA pLKO_005 513 CDS 100% 10.800 7.560 N HELQ n/a
12 TRCN0000051560 CCTAGTAAGAAGAACTGTGAA pLKO.1 1742 CDS 100% 4.950 3.465 N HELQ n/a
13 TRCN0000051558 GCAAATTGTTTCATCAGCAAA pLKO.1 3166 CDS 100% 4.950 3.465 N HELQ n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001297755.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13024 pDONR223 100% 26.3% 26.1% None 807delA;818_3102del n/a
Download CSV