Transcript: Human NM_001297759.1

Homo sapiens helicase, POLQ like (HELQ), transcript variant 6, mRNA.

Source:
NCBI, updated 2018-07-15
Taxon:
Homo sapiens (human)
Gene:
HELQ (113510)
Length:
2580
CDS:
191..1252

Additional Resources:

NCBI RefSeq record:
NM_001297759.1
NBCI Gene record:
HELQ (113510)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001297759.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051562 GCAACCTTACTGAATTACAAA pLKO.1 678 CDS 100% 5.625 7.875 N HELQ n/a
2 TRCN0000051559 GCAGAACTCTTCAAATGATTT pLKO.1 808 CDS 100% 13.200 9.240 N HELQ n/a
3 TRCN0000424253 GGATATGAAGGTGTCACTATT pLKO_005 725 CDS 100% 13.200 9.240 N HELQ n/a
4 TRCN0000426342 TTGGTGACTATGATAGCTTTA pLKO_005 513 CDS 100% 10.800 7.560 N HELQ n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001297759.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13024 pDONR223 100% 77% 76.4% None 807delA;818_1059del n/a
Download CSV