Transcript: Human NM_001300754.2

Homo sapiens solute carrier family 9 member B2 (SLC9B2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
SLC9B2 (133308)
Length:
5774
CDS:
215..1657

Additional Resources:

NCBI RefSeq record:
NM_001300754.2
NBCI Gene record:
SLC9B2 (133308)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001300754.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431932 TTTACTGGACAGGGTCATAAC pLKO_005 460 CDS 100% 10.800 15.120 N SLC9B2 n/a
2 TRCN0000128754 CGTAGGCATTGCAGTATTGAT pLKO.1 1315 CDS 100% 5.625 7.875 N SLC9B2 n/a
3 TRCN0000130075 GCATTGCAGTATTGATACGAA pLKO.1 1320 CDS 100% 3.000 4.200 N SLC9B2 n/a
4 TRCN0000435585 TCACAGTTTCCTGATTCATAT pLKO_005 1998 3UTR 100% 13.200 9.240 N SLC9B2 n/a
5 TRCN0000421325 TCCCAGTCATCAACGATAATG pLKO_005 519 CDS 100% 13.200 9.240 N SLC9B2 n/a
6 TRCN0000130328 GAGAGACTTCTGTGCAAGTTT pLKO.1 1635 CDS 100% 5.625 3.938 N SLC9B2 n/a
7 TRCN0000128451 GAGACAGTTATGAAGCTCAAA pLKO.1 308 CDS 100% 4.950 3.465 N SLC9B2 n/a
8 TRCN0000130694 CATCTGCTCTTCTTGCCCATT pLKO.1 696 CDS 100% 4.050 2.835 N SLC9B2 n/a
9 TRCN0000128354 CAAATGAACCAACAGAAGGAA pLKO.1 339 CDS 100% 3.000 2.100 N SLC9B2 n/a
10 TRCN0000127770 GCAAGGTCACATGGAGAGAAA pLKO.1 1466 CDS 100% 4.950 2.970 N SLC9B2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001300754.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13174 pDONR223 100% 86% 86% None 1_54del;269_270ins171 n/a
2 ccsbBroad304_13174 pLX_304 0% 86% 86% V5 1_54del;269_270ins171 n/a
Download CSV