Transcript: Human NM_001300759.2

Homo sapiens tripartite motif containing 36 (TRIM36), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
TRIM36 (55521)
Length:
4156
CDS:
275..2425

Additional Resources:

NCBI RefSeq record:
NM_001300759.2
NBCI Gene record:
TRIM36 (55521)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001300759.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000040291 CTAGCGATAAACTACAAGAAT pLKO.1 2016 CDS 100% 5.625 7.875 N TRIM36 n/a
2 TRCN0000332998 CTAGCGATAAACTACAAGAAT pLKO_005 2016 CDS 100% 5.625 7.875 N TRIM36 n/a
3 TRCN0000040292 GCCTTGATAAATTGGCACCAT pLKO.1 1535 CDS 100% 2.640 3.696 N TRIM36 n/a
4 TRCN0000332932 GCCTTGATAAATTGGCACCAT pLKO_005 1535 CDS 100% 2.640 3.696 N TRIM36 n/a
5 TRCN0000040288 CGAGGAATCAATGGTCTGTTT pLKO.1 617 CDS 100% 4.950 3.465 N TRIM36 n/a
6 TRCN0000332996 CGAGGAATCAATGGTCTGTTT pLKO_005 617 CDS 100% 4.950 3.465 N TRIM36 n/a
7 TRCN0000040290 CCATTGATTCTCCCTTGCCAA pLKO.1 365 CDS 100% 2.640 1.848 N TRIM36 n/a
8 TRCN0000332995 CCATTGATTCTCCCTTGCCAA pLKO_005 365 CDS 100% 2.640 1.848 N TRIM36 n/a
9 TRCN0000040289 GCTGGATTTAATCTTCTGCTT pLKO.1 1859 CDS 100% 2.640 1.848 N TRIM36 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001300759.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08541 pDONR223 100% 97.8% 97.2% None (many diffs) n/a
2 ccsbBroad304_08541 pLX_304 0% 97.8% 97.2% V5 (many diffs) n/a
3 ccsbBroadEn_15900 pDONR223 0% 97.8% 97.1% None (many diffs) n/a
4 ccsbBroad304_15900 pLX_304 0% 97.8% 97.1% V5 (many diffs) n/a
Download CSV