Transcript: Human NM_001300852.1

Homo sapiens ring finger and CCCH-type domains 1 (RC3H1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-07-23
Taxon:
Homo sapiens (human)
Gene:
RC3H1 (149041)
Length:
11099
CDS:
88..3462

Additional Resources:

NCBI RefSeq record:
NM_001300852.1
NBCI Gene record:
RC3H1 (149041)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001300852.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000177880 CCTAAGAGTATTTCTGCCTTA pLKO.1 1717 CDS 100% 4.050 5.670 N Rc3h1 n/a
2 TRCN0000413305 AGTGTTCAGGAACTAACAATT pLKO_005 1084 CDS 100% 13.200 9.240 N RC3H1 n/a
3 TRCN0000140919 CGGTTTCCTCAAGCCTCTAAA pLKO.1 784 CDS 100% 13.200 9.240 N RC3H1 n/a
4 TRCN0000415281 TACACTCTGTTTGATTAATTG pLKO_005 3791 3UTR 100% 13.200 9.240 N RC3H1 n/a
5 TRCN0000416067 TGCCTCTTTGGGTCAACTTAA pLKO_005 1467 CDS 100% 13.200 9.240 N RC3H1 n/a
6 TRCN0000432078 AGAAGAGATATTCCGAGAAAG pLKO_005 2136 CDS 100% 10.800 7.560 N RC3H1 n/a
7 TRCN0000434165 GGAATGAGGGACCAGCGATTA pLKO_005 2626 CDS 100% 10.800 7.560 N RC3H1 n/a
8 TRCN0000142153 GCTCTGCCAAATGGAATTGTA pLKO.1 1561 CDS 100% 5.625 3.938 N RC3H1 n/a
9 TRCN0000139015 CCAATCTTTGGGCAGCAGTAA pLKO.1 629 CDS 100% 4.950 3.465 N RC3H1 n/a
10 TRCN0000122593 CCCAATTTGCACTCAGACTTT pLKO.1 129 CDS 100% 4.950 3.465 N RC3H1 n/a
11 TRCN0000142634 CCTGCTAGAATCTGTTCCTAA pLKO.1 1701 CDS 100% 4.950 3.465 N RC3H1 n/a
12 TRCN0000144045 CGTGTTGTAAACTCTCAGTAT pLKO.1 2032 CDS 100% 4.950 3.465 N RC3H1 n/a
13 TRCN0000122891 GCAGCAATTGAACCATCAGAT pLKO.1 2997 CDS 100% 4.950 3.465 N RC3H1 n/a
14 TRCN0000122428 GCTGACATCATAGGATGCTAA pLKO.1 4374 3UTR 100% 4.950 3.465 N RC3H1 n/a
15 TRCN0000139559 CCAGCAAACTTGAACCGACTA pLKO.1 1126 CDS 100% 4.050 2.835 N RC3H1 n/a
16 TRCN0000140092 GATCAGGAGTTACTCCCAGTT pLKO.1 3431 CDS 100% 4.050 2.835 N RC3H1 n/a
17 TRCN0000139513 CCTGAATAAACTCCACCGCAA pLKO.1 210 CDS 100% 2.160 1.512 N RC3H1 n/a
18 TRCN0000198362 GCCAAGAAATGTGTAGAAGAA pLKO.1 382 CDS 100% 4.950 2.970 N Rc3h1 n/a
19 TRCN0000200305 GCCTGAATAAACTCCACCGTA pLKO.1 209 CDS 100% 2.640 1.848 N Rc3h1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001300852.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.