Transcript: Human NM_001300867.1

Homo sapiens MIA SH3 domain ER export factor 3 (MIA3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-10
Taxon:
Homo sapiens (human)
Gene:
MIA3 (375056)
Length:
4924
CDS:
174..2531

Additional Resources:

NCBI RefSeq record:
NM_001300867.1
NBCI Gene record:
MIA3 (375056)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001300867.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000256913 CTATATGTCCTCCCGTTTAAT pLKO_005 4152 3UTR 100% 15.000 21.000 N MIA3 n/a
2 TRCN0000256917 TGTTGTGAAGGATAGAGTATA pLKO_005 413 CDS 100% 13.200 18.480 N MIA3 n/a
3 TRCN0000256910 TCGATGAAGGCAAGGTTAATA pLKO_005 2056 CDS 100% 15.000 10.500 N MIA3 n/a
4 TRCN0000256911 TTAGGACTGTGAGGGTTATAA pLKO_005 3539 3UTR 100% 15.000 10.500 N MIA3 n/a
5 TRCN0000256912 GAGCCTCCGTGTCCACTAAAT pLKO_005 1243 CDS 100% 13.200 9.240 N MIA3 n/a
6 TRCN0000256914 GGTAGTTGAAGAGGATCTAAA pLKO_005 1202 CDS 100% 13.200 9.240 N MIA3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001300867.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13632 pDONR223 100% 58.6% 58.4% None 1_972del;1609G>T;1801A>G n/a
2 ccsbBroad304_13632 pLX_304 0% 58.6% 58.4% V5 1_972del;1609G>T;1801A>G n/a
3 TRCN0000465674 TATCTAACCTTTAGAGGGCCCGGT pLX_317 26% 58.6% 58.4% V5 1_972del;1609G>T;1801A>G n/a
Download CSV