Transcript: Human NM_001300925.2

Homo sapiens small integral membrane protein 7 (SMIM7), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-03
Taxon:
Homo sapiens (human)
Gene:
SMIM7 (79086)
Length:
852
CDS:
35..346

Additional Resources:

NCBI RefSeq record:
NM_001300925.2
NBCI Gene record:
SMIM7 (79086)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001300925.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000370238 ACAGGTGACAACATCCGGGAA pLKO_005 152 CDS 100% 2.160 3.024 N SMIM7 n/a
2 TRCN0000343741 ATGATGTTCTGCATGATTGTG pLKO_005 227 CDS 100% 4.950 3.465 N SMIM7 n/a
3 TRCN0000343740 CATCGCCCTGTGGAACATCTT pLKO_005 205 CDS 100% 4.950 3.465 N SMIM7 n/a
4 TRCN0000377528 CGGTGCTGAACTTTAAGCTGA pLKO_005 84 CDS 100% 2.640 1.848 N SMIM7 n/a
5 TRCN0000377469 AGAAGGACACGCAGGGCTTTG pLKO_005 108 CDS 100% 2.000 1.400 N SMIM7 n/a
6 TRCN0000343743 TGCTGAGCCTCAGATACTTTC pLKO_005 177 CDS 100% 10.800 6.480 N SMIM7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001300925.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.