Transcript: Human NM_001300993.2

Homo sapiens zinc finger protein 570 (ZNF570), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
ZNF570 (148268)
Length:
5334
CDS:
120..1898

Additional Resources:

NCBI RefSeq record:
NM_001300993.2
NBCI Gene record:
ZNF570 (148268)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001300993.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000161724 CTTCGTGCATACCTTACTGTA pLKO.1 1392 CDS 100% 4.950 6.930 N ZNF570 n/a
2 TRCN0000161756 CAGAATGCACACCTAGTTCAA pLKO.1 1140 CDS 100% 4.950 3.465 N ZNF570 n/a
3 TRCN0000162337 CCCAAAGAGGAGAAAGTACAT pLKO.1 837 CDS 100% 4.950 3.465 N ZNF570 n/a
4 TRCN0000159298 GAAGAGATAATCACTCATGAA pLKO.1 729 CDS 100% 4.950 3.465 N ZNF570 n/a
5 TRCN0000161512 GCTAGAGAACTACAGGATCTT pLKO.1 416 CDS 100% 4.950 3.465 N ZNF570 n/a
6 TRCN0000161540 GCTCAGCATCAAAGAGTTCAT pLKO.1 1575 CDS 100% 4.950 3.465 N ZNF570 n/a
7 TRCN0000163569 GAGTGGAAATGTGAGGGCTAT pLKO.1 669 CDS 100% 4.050 2.835 N ZNF570 n/a
8 TRCN0000164254 CAAGAGTGTCTGTGCAGAGAA pLKO.1 911 CDS 100% 4.950 2.970 N ZNF570 n/a
9 TRCN0000218427 ACTGGAGAGAAACCCTATAAA pLKO_005 1008 CDS 100% 15.000 7.500 Y ZNF443 n/a
10 TRCN0000374174 ACTGGAGAGAAACCCTATAAA pLKO_005 1008 CDS 100% 15.000 7.500 Y Zfp97 n/a
11 TRCN0000239829 AGGAGAGAAACCCTATGAATG pLKO_005 1346 CDS 100% 10.800 5.400 Y Gm14393 n/a
12 TRCN0000160334 CCTATGAATGTAAGGAATGTA pLKO.1 1105 CDS 100% 5.625 2.813 Y ZNF570 n/a
13 TRCN0000164599 CGGGAGAGAAACCCTATGAAT pLKO.1 1261 CDS 100% 5.625 2.813 Y ZNF570 n/a
14 TRCN0000016730 CTGGAGAGAAACCTTATGAAT pLKO.1 1681 CDS 100% 5.625 2.813 Y ZNF345 n/a
15 TRCN0000151775 CCCTATGAATGTAAGGAATGT pLKO.1 1104 CDS 100% 4.950 2.475 Y ZNF829 n/a
16 TRCN0000262238 TACAGGAGAGAAACCCTATAA pLKO_005 1343 CDS 100% 13.200 6.600 Y Gm14305 n/a
17 TRCN0000243782 TGGAGAGAAACCCTATGAATA pLKO_005 1598 CDS 100% 13.200 6.600 Y Zfp977 n/a
18 TRCN0000284648 ATACAGGAGAGAAACCCTATA pLKO_005 1342 CDS 100% 10.800 5.400 Y Gm14308 n/a
19 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2345 3UTR 100% 5.625 2.813 Y KLHL30 n/a
20 TRCN0000147970 GAATGTAAGGAATGTGGGAAA pLKO.1 1446 CDS 100% 4.050 2.025 Y ZNF700 n/a
21 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2345 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001300993.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.