Transcript: Human NM_001301026.2

Homo sapiens tight junction protein 1 (TJP1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
TJP1 (7082)
Length:
7480
CDS:
174..5252

Additional Resources:

NCBI RefSeq record:
NM_001301026.2
NBCI Gene record:
TJP1 (7082)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001301026.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000303907 GGAACCACTCTATCAAGTATT pLKO_005 5308 3UTR 100% 13.200 18.480 N TJP1 n/a
2 TRCN0000116252 GCAATAAAGCAGCGTTTCTAT pLKO.1 6349 3UTR 100% 5.625 7.875 N TJP1 n/a
3 TRCN0000116253 GCGATCTCATAAACTTCGTAA pLKO.1 2453 CDS 100% 4.950 6.930 N TJP1 n/a
4 TRCN0000300284 GCGATCTCATAAACTTCGTAA pLKO_005 2453 CDS 100% 4.950 6.930 N TJP1 n/a
5 TRCN0000303972 TCGATTGGCAAGCCATATATT pLKO_005 785 CDS 100% 15.000 12.000 N TJP1 n/a
6 TRCN0000303971 CAAGAGAAGAACCAGATATTT pLKO_005 2170 CDS 100% 15.000 10.500 N TJP1 n/a
7 TRCN0000303909 CCATGCAGAGAAGCCTAAATA pLKO_005 4730 CDS 100% 15.000 10.500 N TJP1 n/a
8 TRCN0000116254 CCTGCATACAATAAAGCAAAT pLKO.1 2255 CDS 100% 10.800 7.560 N TJP1 n/a
9 TRCN0000116255 CGACCATTTGAACGCAAGTTT pLKO.1 4554 CDS 100% 5.625 3.938 N TJP1 n/a
10 TRCN0000116256 GCCTGCATACAATAAAGCAAA pLKO.1 2254 CDS 100% 4.950 3.465 N TJP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001301026.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.