Transcript: Human NM_001301082.1

Homo sapiens CCR4-NOT transcription complex subunit 8 (CNOT8), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
CNOT8 (9337)
Length:
2145
CDS:
165..725

Additional Resources:

NCBI RefSeq record:
NM_001301082.1
NBCI Gene record:
CNOT8 (9337)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001301082.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000013411 CCTGGCGATTATCAACAACAT pLKO.1 695 CDS 100% 4.950 6.930 N CNOT8 n/a
2 TRCN0000013408 CCACTTCTCTACTCCATTATT pLKO.1 1605 3UTR 100% 15.000 12.000 N CNOT8 n/a
3 TRCN0000329933 AGTCTGAAACAAAGTAGTAAA pLKO_005 1030 3UTR 100% 13.200 9.240 N CNOT8 n/a
4 TRCN0000329854 ATGAGCATCCTGGCGATTATC pLKO_005 687 CDS 100% 13.200 9.240 N CNOT8 n/a
5 TRCN0000238286 CACTTTGCAGAGCTGCTTATG pLKO_005 249 CDS 100% 10.800 7.560 N Cnot8 n/a
6 TRCN0000013412 GCTGACAGGAATGGCTTTCTT pLKO.1 542 CDS 100% 5.625 3.938 N CNOT8 n/a
7 TRCN0000329931 GCTGACAGGAATGGCTTTCTT pLKO_005 542 CDS 100% 5.625 3.938 N CNOT8 n/a
8 TRCN0000013409 CCCATCCATTTATGATGTGAA pLKO.1 413 CDS 100% 4.950 3.465 N CNOT8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001301082.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02143 pDONR223 100% 63.6% 63.6% None 0_1ins318 n/a
2 ccsbBroad304_02143 pLX_304 0% 63.6% 63.6% V5 0_1ins318 n/a
Download CSV