Transcript: Human NM_001301139.2

Homo sapiens sarcoglycan epsilon (SGCE), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
SGCE (8910)
Length:
1745
CDS:
36..1226

Additional Resources:

NCBI RefSeq record:
NM_001301139.2
NBCI Gene record:
SGCE (8910)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001301139.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414575 ACCTGGATGGCTTCGATATAT pLKO_005 203 CDS 100% 15.000 21.000 N SGCE n/a
2 TRCN0000427296 TGAGACTGCAAGGCATAATTT pLKO_005 329 CDS 100% 15.000 21.000 N SGCE n/a
3 TRCN0000056065 GCAGAGACTATTACACGGATT pLKO.1 841 CDS 100% 4.050 3.240 N SGCE n/a
4 TRCN0000056067 GCCTGTAATAACATGTGATAA pLKO.1 671 CDS 100% 13.200 9.240 N SGCE n/a
5 TRCN0000056063 CGTTGCCATATCAAGCAGAAT pLKO.1 382 CDS 100% 4.950 3.465 N SGCE n/a
6 TRCN0000056066 CCAACAGCAGACTACAGGTAA pLKO.1 1193 CDS 100% 4.950 2.970 N SGCE n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001301139.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07330 pDONR223 100% 90.5% 90.3% None 108_109ins123;1073C>A n/a
2 ccsbBroad304_07330 pLX_304 0% 90.5% 90.3% V5 108_109ins123;1073C>A n/a
Download CSV