Transcript: Mouse NM_001301211.1

Mus musculus adaptor protein complex AP-1, gamma 1 subunit (Ap1g1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Ap1g1 (11765)
Length:
6882
CDS:
384..2852

Additional Resources:

NCBI RefSeq record:
NM_001301211.1
NBCI Gene record:
Ap1g1 (11765)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001301211.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000115374 CGGATCAAGCTCACATATAAT pLKO.1 2766 CDS 100% 15.000 21.000 N Ap1g1 n/a
2 TRCN0000366879 CTGTACTGTAAACCGAATTAA pLKO_005 1997 CDS 100% 15.000 21.000 N Ap1g1 n/a
3 TRCN0000375824 GACAAACGCATTGGCTATTTA pLKO_005 624 CDS 100% 15.000 21.000 N Ap1g1 n/a
4 TRCN0000380508 GACAAACGCATTGGCTATTTA pLKO_005 624 CDS 100% 15.000 21.000 N AP1G1 n/a
5 TRCN0000366930 TTGCGAGTTCTAGCCATAAAT pLKO_005 1296 CDS 100% 15.000 21.000 N Ap1g1 n/a
6 TRCN0000375757 ACCTCATCATGTCCGGATATT pLKO_005 1057 CDS 100% 13.200 18.480 N Ap1g1 n/a
7 TRCN0000381895 ACCTCATCATGTCCGGATATT pLKO_005 1057 CDS 100% 13.200 18.480 N AP1G1 n/a
8 TRCN0000115373 GCGTGGTGTATAGGTGAATAT pLKO.1 1812 CDS 100% 13.200 10.560 N Ap1g1 n/a
9 TRCN0000065149 CCTGAACTTATGGAGATGTTT pLKO.1 888 CDS 100% 5.625 4.500 N AP1G1 n/a
10 TRCN0000366880 AGGCGATTCTCGGTGACTATT pLKO_005 1765 CDS 100% 13.200 9.240 N Ap1g1 n/a
11 TRCN0000115372 CCCAATTAGTTCGTATTCTAA pLKO.1 1033 CDS 100% 5.625 3.938 N Ap1g1 n/a
12 TRCN0000115371 GCTCCCTTTCTCTTCGTTCTT pLKO.1 3594 3UTR 100% 4.950 3.465 N Ap1g1 n/a
13 TRCN0000375823 TGACCTTGAAGCATCAGTAAA pLKO_005 2998 3UTR 100% 13.200 7.920 N Ap1g1 n/a
14 TRCN0000115375 GCTCGCACATTTCAGAAAGAA pLKO.1 1007 CDS 100% 5.625 3.938 N Ap1g1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001301211.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.